| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.205752 |
| Chromosome: | chromosome 10 |
| Location: | 4374332 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g451400 | NIT4,CNX1B,CNX1E | (1 of 1) 2.10.1.1//2.7.7.75 - Molybdopterin molybdotransferase // Molybdopterin adenylyltransferase; Molybdenum cofactor biosynthesis protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGGAATCTCCGGTTGTCGACGTGTGTCCG |
| Internal bar code: | CCCAGCACAGGTCCCGGGAGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 147 |
| LEAP-Seq percent confirming: | 98.2379 |
| LEAP-Seq n confirming: | 223 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGTGTATTTGCGGATGTGA |
| Suggested primer 2: | ACGAGATGAGGGGTGTTACG |