| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.205784 |
| Chromosome: | chromosome 4 |
| Location: | 2361090 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g220900 | GT90-4,GT90F4 | (1 of 52) PF05686 - Glycosyl transferase family 90 (Glyco_transf_90); GT90 family protein 4 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACAATAACAGGGCTCCTGCTGGAAGGTCTC |
| Internal bar code: | ATCACACGCTCCAGACAGGTAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 960 |
| LEAP-Seq percent confirming: | 99.5809 |
| LEAP-Seq n confirming: | 5703 |
| LEAP-Seq n nonconfirming: | 24 |
| LEAP-Seq n unique pos: | 34 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAATTCGTTTCATGTGGTGC |
| Suggested primer 2: | CATAATGCTCAGCGCAGGTA |