| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.205820 |
| Chromosome: | chromosome 9 |
| Location: | 4293732 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g394695 | (1 of 1) K16459 - centrosomal protein CEP120 (CEP120) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGTTGGAGCACGGCCGCGAGTTCCTAGCT |
| Internal bar code: | GACGCTAATGCAATTCTACGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 472 |
| LEAP-Seq percent confirming: | 74.8186 |
| LEAP-Seq n confirming: | 1753 |
| LEAP-Seq n nonconfirming: | 590 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAACAAGGAAGGCGCTGTAG |
| Suggested primer 2: | ACCAGCAGCTCTTCGGTCT |