| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.205896 |
| Chromosome: | chromosome 14 |
| Location: | 4047428 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g633650 | PRP6 | (1 of 1) PTHR11246:SF1 - PRE-MRNA-PROCESSING FACTOR 6; Splicing factor, component of the U4/U6-U5 snRNP complex | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACGCTGCCCCAGCAACCACTTCTGCTGCT |
| Internal bar code: | TTGCGTCATTTCTGGTGAGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 144 |
| LEAP-Seq percent confirming: | 99.8409 |
| LEAP-Seq n confirming: | 1883 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACACTTGCCAGCACACAGAC |
| Suggested primer 2: | TGTGGAACTTTCACGAGCTG |