| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.205945 |
| Chromosome: | chromosome 17 |
| Location: | 1038529 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g703600 | BUG11,OFD1 | Oral-facial-digital syndrome basal body protein 1; (1 of 1) PTHR15431:SF5 - ORAL-FACIAL-DIGITAL SYNDROME 1 PROTEIN | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTAACTAACTCGACACCCCACTGGGGGAA |
| Internal bar code: | TGCAAGTTAACCCTGTATTCAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 155 |
| LEAP-Seq percent confirming: | 23.2143 |
| LEAP-Seq n confirming: | 39 |
| LEAP-Seq n nonconfirming: | 129 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCATTGCAAGCTAGTGGTT |
| Suggested primer 2: | TAATGACGATACGCTCGCAG |