Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.205999 |
Chromosome: | scaffold 19 |
Location: | 18356 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre19.g750197 | (1 of 32) 3.6.4.4 - Plus-end-directed kinesin ATPase / Kinesin | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCAGCACCTGTTTAAAAGTTTTGGATCGCA |
Internal bar code: | ATTACTTCTCTCGGTCGCTAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 369 |
LEAP-Seq percent confirming: | 99.2914 |
LEAP-Seq n confirming: | 2382 |
LEAP-Seq n nonconfirming: | 17 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGCTTCCTCCTCCTCTTTCT |
Suggested primer 2: | GTACCCCATTTGTTGCTGCT |