Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.206087 |
Chromosome: | chromosome 6 |
Location: | 5593078 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g285600 | MID,RWP5 | (1 of 16) PF02042 - RWP-RK domain (RWP-RK); RWP-RK transcription factor | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCGTGCCATCAGTTCGTGCCATCGCCAAA |
Internal bar code: | GGAACGTTTCCTGAGACAAGCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 974 |
LEAP-Seq percent confirming: | 96.9259 |
LEAP-Seq n confirming: | 1608 |
LEAP-Seq n nonconfirming: | 51 |
LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACACATCTGCCCCGACTTAC |
Suggested primer 2: | TTGCGCTCAACATTTCAGAC |