| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.206111 |
| Chromosome: | chromosome 1 |
| Location: | 7555517 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g054500 | (1 of 1) 1.6.1.2 - NAD(P)(+) transhydrogenase (Re/Si-specific) / Transhydrogenase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCACAGATTTTTGGCCACAGGAATCAAGAA |
| Internal bar code: | AGTGGACTCGAGATCAAGGCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 85 |
| LEAP-Seq percent confirming: | 53.6398 |
| LEAP-Seq n confirming: | 280 |
| LEAP-Seq n nonconfirming: | 242 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCAAACAAGGTTGTCCTGT |
| Suggested primer 2: | GAGTTACAGGAGGATGGGCA |