| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.206125 |
| Chromosome: | chromosome 3 |
| Location: | 293978 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g144564 | MMP13 | Matrix metalloproteinase; (1 of 1) IPR008752//IPR024079 - Peptidase M11, gametolysin // Metallopeptidase, catalytic domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTACCCTTGCGCCTCGCGCCTTCAGCCTCG |
| Internal bar code: | CTCGTGCTGCTTTCAGATAAAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 8 |
| LEAP-Seq percent confirming: | 98.9011 |
| LEAP-Seq n confirming: | 180 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACCAGCCCAAACTAAACCG |
| Suggested primer 2: | CACAACCAGTCAGCCAGAGA |