| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.206182 |
| Chromosome: | chromosome 6 |
| Location: | 5107223 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g281000 | (1 of 52) PF00856 - SET domain (SET) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCATGCACGCAAGCATGCGCGCTGTTCTCG |
| Internal bar code: | TAGGGTGACTCCGGCGGTGGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 856 |
| LEAP-Seq percent confirming: | 99.6641 |
| LEAP-Seq n confirming: | 5637 |
| LEAP-Seq n nonconfirming: | 19 |
| LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCATTAGACCTGTCCACGC |
| Suggested primer 2: | CAAATGGACACAACGGACAG |