| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.206235 |
| Chromosome: | chromosome 2 |
| Location: | 2735701 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g093750 | NRX2 | Nucleoredoxin 2; (1 of 3) K17609 - nucleoredoxin [EC:1.8.1.8] (NXN) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAAGGATCACGCACGCAAGGCTGACTGGGA |
| Internal bar code: | AGGCCGATCCGTCGACGCGACA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 249 |
| LEAP-Seq percent confirming: | 99.7523 |
| LEAP-Seq n confirming: | 1208 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTAGAGCGATCGTCCCTTTG |
| Suggested primer 2: | GCATAGCTTCTCCATAGCCG |