| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.206361 |
| Chromosome: | chromosome 12 |
| Location: | 2546851 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g505700 | GTF5 | (1 of 1) K03120 - transcription initiation factor TFIID TATA-box-binding protein (TBP, tbp); TATA sequence-binding protein | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACAGGAAAAAGTTTGCATCGCTTCACAAAG |
| Internal bar code: | CACCAACGTCGACCGAGTCCCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 972 |
| LEAP-Seq percent confirming: | 96.4526 |
| LEAP-Seq n confirming: | 5601 |
| LEAP-Seq n nonconfirming: | 206 |
| LEAP-Seq n unique pos: | 30 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTCTCGAGGGTACAGCAAG |
| Suggested primer 2: | GACAGGGTTTGCCAAGAGAG |