Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.206391 |
Chromosome: | chromosome 7 |
Location: | 5226139 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g348900 | DNJ19 | (1 of 1) K09537 - DnaJ homolog subfamily C member 17 (DNAJC17); DnaJ-like protein | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCCACGGCGGCCACGCCGCTCACATTGGA |
Internal bar code: | GAAAACAATATTTTTTATAATA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 118 |
LEAP-Seq percent confirming: | 18.1818 |
LEAP-Seq n confirming: | 2 |
LEAP-Seq n nonconfirming: | 9 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTTGCTGACCCGTTCCTTAC |
Suggested primer 2: | AAGAATGTGTTTTGTCGCCC |