| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.206417 |
| Chromosome: | chromosome 9 |
| Location: | 7551925 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g414350 | (1 of 3) PF04824//PF04825 - Conserved region of Rad21 / Rec8 like protein (Rad21_Rec8) // N terminus of Rad21 / Rec8 like protein (Rad21_Rec8_N) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGTGTAGCAAGGCGGCGCCGGTGCATGCG |
| Internal bar code: | AAAGTCGAAAAAGGGGGCGTCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 585 |
| LEAP-Seq percent confirming: | 99.8036 |
| LEAP-Seq n confirming: | 5083 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCGTGCACATTTGCATTTAC |
| Suggested primer 2: | TTAACCCCTAAACAGCACGG |