| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.206431 |
| Chromosome: | chromosome 17 |
| Location: | 2336918 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g714400 | (1 of 239) IPR016024 - Armadillo-type fold | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTCATGCTCCGGACCTTAGCATTCAGTCG |
| Internal bar code: | TACTAGTACCGGATGCTAGGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1086 |
| LEAP-Seq percent confirming: | 99.668 |
| LEAP-Seq n confirming: | 11107 |
| LEAP-Seq n nonconfirming: | 37 |
| LEAP-Seq n unique pos: | 48 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCAGAACATCCTGCTGAACG |
| Suggested primer 2: | ACTTCCCCTGTTCACAATGC |