| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.206471 |
| Chromosome: | chromosome 1 |
| Location: | 2806827 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g016570 | (1 of 1) IPR000104//IPR000719//IPR001245//IPR002290//IPR011009//IPR016024//IPR020635 - Antifreeze protein, type I // Protein kinase domain // Serine-threonine/tyrosine-protein kinase catalytic domain // Serine/threonine/dual specificity protein kinase, catalytic domain // Protein kinase-like domain // Armadillo-type fold // Tyrosine-protein kinase, catalytic domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCCCTGCCTAGCCCCGCCTAGCCCTGCCT |
| Internal bar code: | TTCAAGTCCTCTGTCCTGGTTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 245 |
| LEAP-Seq percent confirming: | 99.6772 |
| LEAP-Seq n confirming: | 3705 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGACCTTGTTACCCCTCCC |
| Suggested primer 2: | CTACTTCCACCTGCCGCTAC |