| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.206665 |
| Chromosome: | chromosome 10 |
| Location: | 6361538 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g465550 | CLPD1,CLPD | (1 of 2) 3.6.4.10 - Non-chaperonin molecular chaperone ATPase / Molecular chaperone Hsc70 ATPase; ClpD chaperone, Hsp100 family | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATGCGCACTACCTCCTACGCCCTGCCTCC |
| Internal bar code: | CAGTCGTCGGGGAGGAGCGTCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 120 |
| LEAP-Seq percent confirming: | 99.2553 |
| LEAP-Seq n confirming: | 933 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTTACGAAGTGAAATCGGGG |
| Suggested primer 2: | CATCGTGTCTCGCTCTGTGT |