| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.206684 |
| Chromosome: | chromosome 1 |
| Location: | 3099568 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g019300 | Nucleotidyl cyclase; (1 of 70) 4.6.1.1 - Adenylate cyclase / ATP pyrophosphate-lyase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCCGGCCCCGAGTGCCGCGGTTCGCCATA |
| Internal bar code: | ACCCAGACAAAGCTCGGCCCGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 395 |
| LEAP-Seq percent confirming: | 99.7908 |
| LEAP-Seq n confirming: | 477 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCAACAGACCGGCATACTC |
| Suggested primer 2: | AAACCAGGCGCTACTAAGCA |