Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.206814 |
Chromosome: | chromosome_6 |
Location: | 4887264 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Orientation | Feature |
---|---|---|---|---|
Cre06.g279100 | DPY30 | Subunit of chromatin modifying protein | antisense | 3'UTR |
Insertion site details | |
Flanking sequence (orientation from cassette outwards): | CTTTTGCTGCAACAACAGTTACTCATACAG |
Internal bar code: | ACGGGTCCCGGAGTAGTGACAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 987 |
LEAP-Seq percent confirming: | 99.8884 |
LEAP-Seq n confirming: | 3580 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 33 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTGGCAGATGACTGGTGCTA |
Suggested primer 2: | ACAACCCTGTGGAGTTCCTG |