| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.206814 |
| Chromosome: | chromosome 17 |
| Location: | 4191433 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g730100 | RSE1,RSEP1 | (1 of 3) 3.4.24.85 - S2P endopeptidase / Sterol-regulatory element-binding proteins intramembrane protease; Intramembrane metalloprotease | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGTGATAACGCACGCACGCCCGTGCTTGC |
| Internal bar code: | CCACAGGATGTATTGCACGCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 459 |
| LEAP-Seq percent confirming: | 57.3684 |
| LEAP-Seq n confirming: | 109 |
| LEAP-Seq n nonconfirming: | 81 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGATACGAGACGCTGGTGGT |
| Suggested primer 2: | CAAGGGCGCGTGTATAAAAT |