| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.206833 |
| Chromosome: | chromosome 14 |
| Location: | 586546 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g611850 | (1 of 1) K17087 - transmembrane 9 superfamily member 3 (TM9SF3) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATCCGAAGGGCAGCAGGCCGCCGGCGGCG |
| Internal bar code: | TACACGATGCGGATCGCGACGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 603 |
| LEAP-Seq percent confirming: | 95.5435 |
| LEAP-Seq n confirming: | 879 |
| LEAP-Seq n nonconfirming: | 41 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCTGGAAGTTTCTTTGAGG |
| Suggested primer 2: | GCACCGAGTAGAGGAAGACG |