| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.206869 |
| Chromosome: | chromosome 10 |
| Location: | 4304622 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g450850 | (1 of 1) PF00168//PF16016 - C2 domain (C2) // Domain of unknown function (DUF4782) (DUF4782) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGAACACGTCCCGTGTCTCCCCCTCTCCCC |
| Internal bar code: | ACAGGCGGCCTCGTGCCTGTGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 265 |
| LEAP-Seq percent confirming: | 95.1807 |
| LEAP-Seq n confirming: | 79 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGAGGAGGTGGTGTACAGGT |
| Suggested primer 2: | ATGTGCAGCTGGTACTCGTG |