Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.206924 |
Chromosome: | chromosome 8 |
Location: | 4079587 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g379500 | (1 of 1) IPR000719//IPR002290//IPR011009//IPR020635//IPR029016 - Protein kinase domain // Serine/threonine/dual specificity protein kinase, catalytic domain // Protein kinase-like domain // Tyrosine-protein kinase, catalytic domain // GAF domain-like | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTTCTGCGCTTGGCCCGGCGTGGCGCCAC |
Internal bar code: | CCTATAGAGCCGGCGCCACTAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 904 |
LEAP-Seq percent confirming: | 99.5663 |
LEAP-Seq n confirming: | 3214 |
LEAP-Seq n nonconfirming: | 14 |
LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTAGCTTGTAGCTGGCCTGG |
Suggested primer 2: | AGCTTTACCACCACCACGTC |