Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.206952 |
Chromosome: | chromosome 1 |
Location: | 1058262 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g006150 | EFG9,PRFC1, PRFC1,PRF3 | (1 of 1) PTHR23115//PTHR23115:SF69 - TRANSLATION FACTOR // PEPTIDE CHAIN RELEASE FACTOR 3; Putative chloroplast translation peptide-chain release factor 3 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAAGGGTACACTATCTATGGCGTCGAGGCA |
Internal bar code: | CTTGATTCCCGGCACTCGATGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 199 |
LEAP-Seq percent confirming: | 99.7126 |
LEAP-Seq n confirming: | 347 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCCCAAGCTATACCAAACCA |
Suggested primer 2: | TAACAGGTCGTCCAGGAACC |