| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.206965 |
| Chromosome: | chromosome 12 |
| Location: | 2990466 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g501100 | TMU3,TRM2A | (1 of 1) 2.1.1.189//2.1.1.190 - 23S rRNA (uracil(747)-C(5))-methyltransferase // 23S rRNA (uracil(1939)-C(5))-methyltransferase / RNA uridine methyltransferase A; tRNA (uracil-5-)-methyltransferase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCTCTCCTCCTCGCTCTATCGCGTTGGGT |
| Internal bar code: | TTATCCGTTGCGGGAAGTTCCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 460 |
| LEAP-Seq percent confirming: | 99.6725 |
| LEAP-Seq n confirming: | 3043 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCATCAATCATCACGTGCC |
| Suggested primer 2: | CCCGGTTGTTCATTTGAGTT |