Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.207006 |
Chromosome: | chromosome 9 |
Location: | 4205429 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g394251 | PF16 | Central pair associated protein; (1 of 1) PF00514//PF13513 - Armadillo/beta-catenin-like repeat (Arm) // HEAT-like repeat (HEAT_EZ) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTTGACCCCGGCGTCAAGGAGGCCTCAGC |
Internal bar code: | TATATCACTGCAGCATCCTATT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 145 |
LEAP-Seq percent confirming: | 99.3127 |
LEAP-Seq n confirming: | 867 |
LEAP-Seq n nonconfirming: | 6 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCAAGTGAGAATTTTGGGGA |
Suggested primer 2: | CACCTTACTTCTTAGCGCCG |