| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.207029 |
| Chromosome: | chromosome 3 |
| Location: | 5092937 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g181350 | bL17m,MRPL17 | Mitochondrial ribosomal protein L17; (1 of 2) K02879 - large subunit ribosomal protein L17 (RP-L17, MRPL17, rplQ) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCATGCCCGATGCATTCACCCAAGAAGTA |
| Internal bar code: | CGTACCAGGGCGCTGATTGGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 750 |
| LEAP-Seq percent confirming: | 99.4236 |
| LEAP-Seq n confirming: | 2760 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGACATGAATGTTGGAGCCT |
| Suggested primer 2: | GGAGCCTCCTGACTCTTTCC |