Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.207152 |
Chromosome: | chromosome 7 |
Location: | 5190492 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g348550 | TGL13 | (1 of 3) PTHR21493:SF153 - PROTEIN T08B1.4, ISOFORM B-RELATED; Putative triacylglycerol lipase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTTGTTGCTTGCAGCATGCTGGCTGCATC |
Internal bar code: | CGAGTTTCGTTTTGGTTCGTCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 606 |
LEAP-Seq percent confirming: | 99.4298 |
LEAP-Seq n confirming: | 7324 |
LEAP-Seq n nonconfirming: | 42 |
LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TAGTGATGTTGTACCCGCCA |
Suggested primer 2: | GTTTCCTGTGCGGAAGAGAG |