| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.207152 |
| Chromosome: | chromosome 7 |
| Location: | 5190492 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g348550 | TGL13 | (1 of 3) PTHR21493:SF153 - PROTEIN T08B1.4, ISOFORM B-RELATED; Putative triacylglycerol lipase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACAAAAGTCTCACGGGAACCTGAAGAGGA |
| Internal bar code: | GGGTCGATCATAGTACGTTTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1148 |
| LEAP-Seq percent confirming: | 99.2483 |
| LEAP-Seq n confirming: | 8978 |
| LEAP-Seq n nonconfirming: | 68 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAGTGATGTTGTACCCGCCA |
| Suggested primer 2: | GTTTCCTGTGCGGAAGAGAG |