| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.207232 |
| Chromosome: | chromosome 9 |
| Location: | 4200478 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g394176 | (1 of 21) IPR000679 - Zinc finger, GATA-type | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGATTCAAGATCTCGGCGTTGGTGCATCAG |
| Internal bar code: | AGGATGTCTACTTGCGTGGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 157 |
| LEAP-Seq percent confirming: | 99.6102 |
| LEAP-Seq n confirming: | 1789 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGATGAGAAGGAGGAGGAGG |
| Suggested primer 2: | AGATAGCATGTCAGGGTGGC |