| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.207373 |
| Chromosome: | chromosome 13 |
| Location: | 5180587 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g607850 | (1 of 7) PF00076//PF14259 - RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain) (RRM_1) // RNA recognition motif (a.k.a. RRM, RBD, or RNP domain) (RRM_6) | 3'UTR_intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCAGGCTGACCTCATAGGGCTTCGTGGTA |
| Internal bar code: | CGTGGGGGACCTTTGATAATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 943 |
| LEAP-Seq percent confirming: | 99.5489 |
| LEAP-Seq n confirming: | 662 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTAGGGCAGATATCGCTTGC |
| Suggested primer 2: | TGGCACTTGCCAGTAGACAG |