| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.207458 |
| Chromosome: | chromosome 16 |
| Location: | 6517390 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g672800 | VTC1,GMP1 | GDP-mannose pyrophosphorylase; (1 of 1) 2.7.7.13//2.7.7.22 - Mannose-1-phosphate guanylyltransferase / GTP-mannose-1-phosphate guanylyltransferase // Mannose-1-phosphate guanylyltransferase (GDP) / GDP-mannose pyrophosphorylase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTAGTTTACCGCCAGAGTCGTCGCAACCC |
| Internal bar code: | TTTTATATCGCAGGCGCTTTCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 331 |
| LEAP-Seq percent confirming: | 98.8889 |
| LEAP-Seq n confirming: | 623 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAAGGACCACTCCAAGGTGG |
| Suggested primer 2: | CCGCTACAGCTTTCAGGAAC |