Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.207494 |
Chromosome: | chromosome 9 |
Location: | 1444809 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g398400 | TRP5 | Transient receptor potential ion channel protein; (1 of 46) PF00520 - Ion transport protein (Ion_trans) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTCTACAATCCGTTTGCCAGCAGCCCCCC |
Internal bar code: | GGGGCCTACATGGCTCGGGATT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 816 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 83 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAAGTCTGCAAGGGTCGAAG |
Suggested primer 2: | TCTTCCTGGGCATTATCTGG |