| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.207557 |
| Chromosome: | chromosome 1 |
| Location: | 2228044 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g012200 | (1 of 3) PF00651//PF03110 - BTB/POZ domain (BTB) // SBP domain (SBP) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGGCTGCAGTATGGGTTCAGCATGTACCG |
| Internal bar code: | CCGCGGGCGCAGTACCGGGCTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 858 |
| LEAP-Seq percent confirming: | 85.4402 |
| LEAP-Seq n confirming: | 3562 |
| LEAP-Seq n nonconfirming: | 607 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTCACTTCGTTCCGTCCAT |
| Suggested primer 2: | TCGAGCCCTTCTGTGTTTCT |