| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.207618 |
| Chromosome: | chromosome 16 |
| Location: | 2893670 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g663750 | (1 of 10) PF13519 - von Willebrand factor type A domain (VWA_2) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGCTGAAGGCGGCCGCCGGTCGCGAGGCC |
| Internal bar code: | GTGGGCTTGGCCAATGGGGACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 477 |
| LEAP-Seq percent confirming: | 97.7957 |
| LEAP-Seq n confirming: | 1331 |
| LEAP-Seq n nonconfirming: | 30 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAAGAACACAAAGCAGCAC |
| Suggested primer 2: | TCATTCAAGTGCAGTGAGGC |