Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.207685 |
Chromosome: | chromosome 17 |
Location: | 2600506 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g717000 | (1 of 7) PF02190 - ATP-dependent protease La (LON) substrate-binding domain (LON_substr_bdg) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCAATGCAAAAGAGCGAGGAGGTGGTGAGG |
Internal bar code: | GCACCGATGTGTTAGGCAGTAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1039 |
LEAP-Seq percent confirming: | 98.6148 |
LEAP-Seq n confirming: | 5624 |
LEAP-Seq n nonconfirming: | 79 |
LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CATGTCGATTGTTTCGTTGG |
Suggested primer 2: | TACAGCTCGCCATGCTACAC |