| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.207741 |
| Chromosome: | chromosome 9 |
| Location: | 5257787 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g399663 | FXL7,FXL4 | FixL-like PAS domain protein; (1 of 11) PF13426 - PAS domain (PAS_9) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTGGCGCCTGGCGGCCGCCCCAAGATCAC |
| Internal bar code: | AAGTTCGGGAGGTCCCGGCGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 366 |
| LEAP-Seq percent confirming: | 96.9466 |
| LEAP-Seq n confirming: | 635 |
| LEAP-Seq n nonconfirming: | 20 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCACACACACACCTCTCCAC |
| Suggested primer 2: | CTGGTGTTCTTGGTGAGGGT |