Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.207745 |
Chromosome: | chromosome 14 |
Location: | 975565 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g614000 | CGL17 | Conserved in the Green Lineage; (1 of 1) PTHR35699:SF1 - F2J10.10 PROTEIN | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAAGGAGCTGGCTCGGAGAGGCCTCAACTC |
Internal bar code: | GAGTGACTTGACCCCAGCGCGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 345 |
LEAP-Seq percent confirming: | 99.6171 |
LEAP-Seq n confirming: | 1561 |
LEAP-Seq n nonconfirming: | 6 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTGCGGTTGTAACAGGGAAT |
Suggested primer 2: | GCCCTTCCCAACTTTACACA |