Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.207779 |
Chromosome: | chromosome 14 |
Location: | 409444 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g610631 | (1 of 25) IPR000210//IPR011333 - BTB/POZ domain // POZ domain | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGTGAAACAGGTATGAGATAATGCAGTAC |
Internal bar code: | TCGCTACCGTGCAACGTGATGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 864 |
LEAP-Seq percent confirming: | 99.5868 |
LEAP-Seq n confirming: | 1205 |
LEAP-Seq n nonconfirming: | 5 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAAGGGACACAGGAGTGGTT |
Suggested primer 2: | ATCGACGACCAACAGGCTAC |