| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.207792 |
| Chromosome: | chromosome 16 |
| Location: | 2414757 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g660390 | CSR1 | (1 of 1) PF00415//PF00685 - Regulator of chromosome condensation (RCC1) repeat (RCC1) // Sulfotransferase domain (Sulfotransfer_1); Carbohydrate sulfotransferase-related 1 | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTCAAAATCGCGCTTTGGAAATCGACCCC |
| Internal bar code: | TGGGAGGAAGTGTGGTTTATCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 931 |
| LEAP-Seq percent confirming: | 99.6867 |
| LEAP-Seq n confirming: | 4454 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGTTGACATGGTTGACTTG |
| Suggested primer 2: | AACCAAATTGCATCAAAGCC |