| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.208083 |
| Chromosome: | chromosome 17 |
| Location: | 1471808 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g706900 | CNG3 | Cyclic-nucleotide gated potassium channel; (1 of 4) IPR000595//IPR003938//IPR005821//IPR018490 - Cyclic nucleotide-binding domain // Potassium channel, voltage-dependent, EAG/ELK/ERG // Ion transport domain // Cyclic nucleotide-binding-like | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGAGATTGCCCACAAGGAGGTCTTTTAGTG |
| Internal bar code: | ATCACAGGCCCCCCGTCGGCCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 180 |
| LEAP-Seq percent confirming: | 66.6667 |
| LEAP-Seq n confirming: | 1058 |
| LEAP-Seq n nonconfirming: | 529 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACAGCAAGATCAGCAACGTG |
| Suggested primer 2: | AAGATGGGCAAGATCCACAC |