| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.208200 |
| Chromosome: | chromosome 6 |
| Location: | 1825324 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g262700 | QCR7 | (1 of 1) K00417 - ubiquinol-cytochrome c reductase subunit 7 (QCR7, UQCRB); Ubiquinol:cytochrome c oxidoreductase 14 kDa subunit, mitochondrial | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGACGGGAGGCACCACATGCCCCCGCGTA |
| Internal bar code: | AGGATCTATGGAGAGTCATGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 956 |
| LEAP-Seq percent confirming: | 97.1381 |
| LEAP-Seq n confirming: | 11744 |
| LEAP-Seq n nonconfirming: | 346 |
| LEAP-Seq n unique pos: | 62 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGAGGTAAGTGGGACGATGT |
| Suggested primer 2: | GCGTAGCAAGAAGGGACAAG |