Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.208200 |
Chromosome: | chromosome 6 |
Location: | 1825324 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g262700 | QCR7 | (1 of 1) K00417 - ubiquinol-cytochrome c reductase subunit 7 (QCR7, UQCRB); Ubiquinol:cytochrome c oxidoreductase 14 kDa subunit, mitochondrial | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGACGGGAGGCACCACATGCCCCCGCGTA |
Internal bar code: | AGGATCTATGGAGAGTCATGTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 956 |
LEAP-Seq percent confirming: | 97.1381 |
LEAP-Seq n confirming: | 11744 |
LEAP-Seq n nonconfirming: | 346 |
LEAP-Seq n unique pos: | 62 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGAGGTAAGTGGGACGATGT |
Suggested primer 2: | GCGTAGCAAGAAGGGACAAG |