| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.208342 |
| Chromosome: | chromosome 9 |
| Location: | 934914 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g401022 | SNE3, UXE,UXE1 | UDP-xylose-4-epimerase; (1 of 1) K12448 - UDP-arabinose 4-epimerase (UXE, uxe) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGGACGCGCAACACCACACCTGCTGTCTA |
| Internal bar code: | ACCAGGTCCGCGGTGTGGCTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 517 |
| LEAP-Seq percent confirming: | 99.2064 |
| LEAP-Seq n confirming: | 250 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTAAATGTCGGCTGCAAAT |
| Suggested primer 2: | AAGAAGTGAAGGCGTAGCCA |