| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.208349 |
| Chromosome: | chromosome 2 |
| Location: | 375659 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g075850 | STK12,SNRK2A,SNRK2,STPK12,ARS11 | (1 of 107) IPR000719//IPR002290//IPR011009//IPR020635 - Protein kinase domain // Serine/threonine/dual specificity protein kinase, catalytic domain // Protein kinase-like domain // Tyrosine-protein kinase, catalytic domain; snRK1 family in Chlamydomonas, subgroup 2 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGAGAAGTGGGGGGTTGGGGGTTAGCCGTT |
| Internal bar code: | GACCCAGAGGGGGGTTAATTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 584 |
| LEAP-Seq percent confirming: | 99.2958 |
| LEAP-Seq n confirming: | 987 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACATGATGCCGTTTACTGG |
| Suggested primer 2: | GCTGCTACTGCTGCTGACAC |