| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.208440 |
| Chromosome: | chromosome 10 |
| Location: | 6022006 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g463026 | (1 of 1) IPR001202//IPR001752//IPR027417//IPR027640 - WW domain // Kinesin motor domain // P-loop containing nucleoside triphosphate hydrolase // Kinesin-like protein; Large protein with small region (p-loop?) Similar to kinesin (peptide is unique) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCCCTCGCACACACGCGCCTGCTCGCTCC |
| Internal bar code: | CGTCTGCGGATCTTATTCGACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 989 |
| LEAP-Seq percent confirming: | 89.3337 |
| LEAP-Seq n confirming: | 3191 |
| LEAP-Seq n nonconfirming: | 381 |
| LEAP-Seq n unique pos: | 30 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGTTTAGTTTGGGCTGGTA |
| Suggested primer 2: | TGCGAGTGAGTGTGTGATGA |