Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.208506 |
Chromosome: | chromosome 12 |
Location: | 220170 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g485000 | FAP182 | (1 of 2) PTHR20899:SF1 - UPF0691 PROTEIN C9ORF116; Flagellar Associated Protein 182 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTGCACCATGCGCCTACAACATAGCGCTG |
Internal bar code: | CCGGCCATATTTGCACCGGCAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 738 |
LEAP-Seq percent confirming: | 99.7449 |
LEAP-Seq n confirming: | 1564 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCTGTACAACGCCTTCTTCC |
Suggested primer 2: | TGTCTGTAGGAATGGGAGGG |