Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.208532 |
Chromosome: | chromosome 14 |
Location: | 1174637 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g615800 | (1 of 3) PTHR31563:SF1 - ION CHANNEL POLLUX-RELATED | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGCAGCAATGCGCACCTGAGCGCCGAGGA |
Internal bar code: | TCTCAAGTGATCCAGCCATAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 108 |
LEAP-Seq percent confirming: | 99.2976 |
LEAP-Seq n confirming: | 1131 |
LEAP-Seq n nonconfirming: | 8 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTGCTGCTGTTGTTGTTGGT |
Suggested primer 2: | TTCACGGACATCGGTAACAA |