| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.208535 |
| Chromosome: | chromosome 10 |
| Location: | 3761600 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g446650 | HEL46,MER | (1 of 1) K15271 - ATP-dependent DNA helicase HFM1/MER3 [EC:3.6.4.12] (HFM1, MER3); conserved protein with DEAD/DEAH box helicase domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTTGGGCCTAGAGGCACCGAGCCCGTTGT |
| Internal bar code: | TCGGACCTCTCGACGAACGCTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 667 |
| LEAP-Seq percent confirming: | 99.5008 |
| LEAP-Seq n confirming: | 6577 |
| LEAP-Seq n nonconfirming: | 33 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATTTGCTCACAGACACACGC |
| Suggested primer 2: | TGCTGTACCGTAGCATCGTC |