| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.208733 |
| Chromosome: | chromosome 14 |
| Location: | 543276 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g611552 | TGL22 | (1 of 32) 3.1.1.3 - Triacylglycerol lipase / Triglyceride lipase; Putative triacylglycerol lipase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTGAAACCGGTGACTCTCTAGCCTCCTCC |
| Internal bar code: | TTGATCGCTCAGAGGGCACTAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 579 |
| LEAP-Seq percent confirming: | 21.8487 |
| LEAP-Seq n confirming: | 104 |
| LEAP-Seq n nonconfirming: | 372 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACCCCAATAATGCTTTCCC |
| Suggested primer 2: | CGCTACAGCTTATGGGCTTC |