| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.208840 |
| Chromosome: | chromosome 13 |
| Location: | 661469 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g566150 | RMR1 | (1 of 1) 2.1.1.185 - 23S rRNA (guanosine(2251)-2'-O)-methyltransferase; Putative RNA 2'-O ribose methyltransferase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTTCCAAAGCTCCAGGGTTCCATGAAACG |
| Internal bar code: | GAGATTAGCAGGCGGAACCCTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 498 |
| LEAP-Seq percent confirming: | 99.6994 |
| LEAP-Seq n confirming: | 3648 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCTTCATACGTGTCCTGCC |
| Suggested primer 2: | CATGTCTGCGGCACTTAGAA |